| Detail of EST/Unigene AL366948 |
| Acc. | AL366948 |
| Internal Acc. | MtBA11B11R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=6e-22; Transketolase, chloroplastic OS=Spinacia oleracea E-value=2e-19; Transketolase, chloroplastic OS=Solanum tuberosum E-value=3e-19; Transketolase 7 OS=Craterostigma plantagineum E-value=4e-19; Transketolase, chloroplastic OS=Zea mays E-value=8e-19; |
| Length | 469 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | GGCTAGGGTTAGCATTGAGGCCGGATCAACATTCGGGTGGGAGAAAATTGTTGGAAGCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819137 |
| Trichome-related Gene from Literature | N/A |