Detail of EST/Unigene AL367035 |
Acc. | AL367035 |
Internal Acc. | MtBA11G12F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-amyrin 24-hydroxylase OS=Glycine max E-value=8e-56; Cytochrome P450 93A3 OS=Glycine max E-value=3e-24; Cytochrome P450 93A1 OS=Glycine max E-value=4e-21; Cytochrome P450 71B2 OS=Arabidopsis thaliana E-value=3e-20; Cytochrome P450 71B12 OS=Arabidopsis thaliana E-value=8e-20; |
Length | 469 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | GTTGTGTTTGGTATTTTGCATTGACAACATTGTCCTTTTTTGTCACACCAATTACCAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830580 |
Trichome-related Gene from Literature | N/A |