Detail of EST/Unigene AL367202 |
Acc. | AL367202 |
Internal Acc. | MtBA12H02F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-41; Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=2e-41; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=9e-41; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=8e-38; Ketol-acid reductoisomerase OS=Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis) E-value=1e-06; |
Length | 316 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | CACAGGGACCTGCTCAAGCACAGAATCTACGGGACTCACTTGCTGAAGCTAAGTCTGATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |