Detail of EST/Unigene AL367441 |
Acc. | AL367441 |
Internal Acc. | MtBA15A06R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable phospholipid hydroperoxide glutathione peroxidase OS=Helianthus annuus E-value=6e-39; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=3e-37; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana tabacum E-value=6e-37; Probable phospholipid hydroperoxide glutathione peroxidase OS=Citrus sinensis E-value=1e-36; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=2e-36; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | AAATTACAAAGAGTTGAATGTTCTGTACCAGAAGTACAAGGATCAAGACTTTGAAATCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818936 |
Trichome-related Gene from Literature | N/A |