Detail of EST/Unigene AL367860 |
Acc. | AL367860 |
Internal Acc. | MtBA19G05F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Secologanin synthase OS=Catharanthus roseus E-value=5e-36; Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=2e-31; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=1e-28; Cytochrome P450 734A2 OS=Oryza sativa subsp. japonica E-value=8e-27; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=1e-26; |
Length | 359 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | GAAAGTCTAAGGTTATACCCACCAGTTATTATGCTATCTCGATTTCTTCGCANAGACACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07424 cytochrome P450, family 3, subfamily A |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820696 |
Trichome-related Gene from Literature | N/A |