| Detail of EST/Unigene AL368218 |
| Acc. | AL368218 |
| Internal Acc. | MtBA22H09F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=4e-62; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=8e-40; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=5e-34; Cytochrome P450 82G1 OS=Arabidopsis thaliana E-value=3e-27; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=3e-27; |
| Length | 371 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | CTCATGTAGGACAAGATCGTTTGGTTGATGAATCAGACCTTCCGAAACTAACTTACCTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829888 |
| Trichome-related Gene from Literature | N/A |