| Detail of EST/Unigene AL368276 |
| Acc. | AL368276 |
| Internal Acc. | MtBA23D03F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Uridine 5'-monophosphate synthase OS=Arabidopsis thaliana E-value=5e-16; Uridine 5'-monophosphate synthase (Fragment) OS=Nicotiana tabacum E-value=6e-13; Uridine 5'-monophosphate synthase OS=Drosophila melanogaster E-value=2e-10; Uridine 5'-monophosphate synthase OS=Bos taurus E-value=9e-10; Uridine 5'-monophosphate synthase OS=Dictyostelium discoideum E-value=3e-09; |
| Length | 237 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | CTTGAAACATATGCAGCAGCGGCAATAACAACACTCGCCATCGTACAAAGGTTTTAGATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01591 orotidine-5'-phosphate decarboxylase |
| EC | 2.4.2.10 4.1.1.23 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824612 |
| Trichome-related Gene from Literature | N/A |