Detail of EST/Unigene AL368276 |
Acc. | AL368276 |
Internal Acc. | MtBA23D03F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Uridine 5'-monophosphate synthase OS=Arabidopsis thaliana E-value=5e-16; Uridine 5'-monophosphate synthase (Fragment) OS=Nicotiana tabacum E-value=6e-13; Uridine 5'-monophosphate synthase OS=Drosophila melanogaster E-value=2e-10; Uridine 5'-monophosphate synthase OS=Bos taurus E-value=9e-10; Uridine 5'-monophosphate synthase OS=Dictyostelium discoideum E-value=3e-09; |
Length | 237 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | CTTGAAACATATGCAGCAGCGGCAATAACAACACTCGCCATCGTACAAAGGTTTTAGATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01591 orotidine-5'-phosphate decarboxylase |
EC | 2.4.2.10 4.1.1.23 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824612 |
Trichome-related Gene from Literature | N/A |