| Detail of EST/Unigene AL368900 |
| Acc. | AL368900 |
| Internal Acc. | MtBA27E05F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase 3 OS=Stylosanthes humilis E-value=6e-49; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=2e-47; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=1e-45; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=3e-45; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=4e-44; |
| Length | 332 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | CAGAAGCTAAAGTATTCGAACATCCTAAGAAGGCCTTTGGTTGGGCAGCTAGAGATTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829955 |
| Trichome-related Gene from Literature | 829955 |