| Detail of EST/Unigene AL368916 |
| Acc. | AL368916 |
| Internal Acc. | MtBA27F07F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 OS=Brassica oleracea E-value=2e-36; 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 OS=Brassica napus E-value=3e-36; 1-acyl-sn-glycerol-3-phosphate acyltransferase 2 OS=Arabidopsis thaliana E-value=3e-35; 1-acyl-sn-glycerol-3-phosphate acyltransferase PLS1 OS=Zea mays E-value=1e-34; 1-acyl-sn-glycerol-3-phosphate acyltransferase 3 OS=Arabidopsis thaliana E-value=1e-32; |
| Length | 385 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | TAGTAAGTAACAAGACAGGATCATCATCATCATCGACAACAAAGGAAAACATCTAGCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase |
| EC | 2.3.1.51 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824934 |
| Trichome-related Gene from Literature | N/A |