Detail of EST/Unigene AL369470 |
Acc. | AL369470 |
Internal Acc. | MtBA31C11F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=2e-34; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-33; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=9e-33; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=4e-32; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=6e-32; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | TTAAAAAGAAACTCTTCGATTGATCATGTCTATCATTTTTCTGTTTGTTGGTATACTGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824891 |
Trichome-related Gene from Literature | N/A |