| Detail of EST/Unigene AL369475 |
| Acc. | AL369475 |
| Internal Acc. | MtBA31D02F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histamine oxidase OS=Arthrobacter globiformis E-value=1e-32; Phenylethylamine oxidase OS=Arthrobacter globiformis E-value=9e-32; Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-30; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-30; Copper amine oxidase 1 OS=Aspergillus niger E-value=9e-21; |
| Length | 476 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | CACAACAATGCATTTTATGCCGAGGAAAAACTGCTTAAATCAGAATTAGAAGCAATGCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K11182 diamine oxidase |
| EC | 1.4.3.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818849 |
| Trichome-related Gene from Literature | N/A |