Detail of EST/Unigene AL369475 |
Acc. | AL369475 |
Internal Acc. | MtBA31D02F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Histamine oxidase OS=Arthrobacter globiformis E-value=1e-32; Phenylethylamine oxidase OS=Arthrobacter globiformis E-value=9e-32; Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-30; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=2e-30; Copper amine oxidase 1 OS=Aspergillus niger E-value=9e-21; |
Length | 476 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | CACAACAATGCATTTTATGCCGAGGAAAAACTGCTTAAATCAGAATTAGAAGCAATGCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K11182 diamine oxidase |
EC | 1.4.3.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818849 |
Trichome-related Gene from Literature | N/A |