Detail of EST/Unigene AL370733 |
Acc. | AL370733 |
Internal Acc. | MtBA39F03F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Coproporphyrinogen-III oxidase, chloroplastic OS=Glycine max E-value=8e-22; Coproporphyrinogen-III oxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-17; Coproporphyrinogen-III oxidase, chloroplastic OS=Nicotiana tabacum E-value=1e-15; Coproporphyrinogen-III oxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-15; Coproporphyrinogen-III oxidase, chloroplastic OS=Hordeum vulgare E-value=4e-13; |
Length | 468 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | TTCATTTTCAAACCCCCTCTTTCTCTTCTCTTCTTCCTTTCTTCATTTCTCTGTTACAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828029 |
Trichome-related Gene from Literature | N/A |