| Detail of EST/Unigene AL370733 |
| Acc. | AL370733 |
| Internal Acc. | MtBA39F03F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Coproporphyrinogen-III oxidase, chloroplastic OS=Glycine max E-value=8e-22; Coproporphyrinogen-III oxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-17; Coproporphyrinogen-III oxidase, chloroplastic OS=Nicotiana tabacum E-value=1e-15; Coproporphyrinogen-III oxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-15; Coproporphyrinogen-III oxidase, chloroplastic OS=Hordeum vulgare E-value=4e-13; |
| Length | 468 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | TTCATTTTCAAACCCCCTCTTTCTCTTCTCTTCTTCCTTTCTTCATTTCTCTGTTACAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828029 |
| Trichome-related Gene from Literature | N/A |