| Detail of EST/Unigene AL370828 |
| Acc. | AL370828 |
| Internal Acc. | MtBA40B11F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens E-value=2e-15; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=3e-15; Serine hydroxymethyltransferase OS=Caenorhabditis elegans E-value=5e-15; Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=5e-15; Serine hydroxymethyltransferase OS=Salinibacter ruber (strain DSM 13855 / M31) E-value=5e-15; |
| Length | 162 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | ATCCACGACCTAATCGAAAAAGAAAAACGTCGCCAATGCCGCGGAATCGAACTCATCGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827027 |
| Trichome-related Gene from Literature | N/A |