Detail of EST/Unigene AL370834 |
Acc. | AL370834 |
Internal Acc. | MtBA40C02F2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=8e-53; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-42; Beta-glucosidase 8 OS=Arabidopsis thaliana E-value=3e-38; Beta-glucosidase 1 OS=Arabidopsis thaliana E-value=8e-37; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-36; |
Length | 368 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | GAAGATGGAATCACATACATGTTTGACTCTTGTTTTCTTTGTGCTTGTAAACTTGGCTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |