Detail of EST/Unigene AL371115 |
Acc. | AL371115 |
Internal Acc. | MtBA42A03F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S19, chloroplastic OS=Glycine max E-value=1e-33; 30S ribosomal protein S19, chloroplastic OS=Phaseolus vulgaris E-value=1e-33; 30S ribosomal protein S19, chloroplastic OS=Phaseolus angularis E-value=1e-33; 30S ribosomal protein S19, chloroplastic OS=Pisum sativum E-value=1e-33; 30S ribosomal protein S19, chloroplastic OS=Manihot esculenta E-value=2e-33; |
Length | 486 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | AAAAAATAAATATAGTGATAATTTGATTCTTCGTCGCCGTAGTAAATAGTCTAGAGTAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |