| Detail of EST/Unigene AL371126 |
| Acc. | AL371126 |
| Internal Acc. | MtBA42A09R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=1e-24; Secologanin synthase OS=Catharanthus roseus E-value=3e-23; Cytochrome P450 734A2 OS=Oryza sativa subsp. japonica E-value=4e-17; Cytochrome P450 734A4 OS=Oryza sativa subsp. japonica E-value=2e-16; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=2e-16; |
| Length | 387 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | ATTTCAAACCAGAAAGATTCTCTGAAGGAGTTTCAAAGGCAACAAATGGCAAAGTTTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
| EC | 1.14.15.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820696 |
| Trichome-related Gene from Literature | N/A |