Detail of EST/Unigene AL371191 |
Acc. | AL371191 |
Internal Acc. | MtBA42E02F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 6,7-dimethyl-8-ribityllumazine synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-19; 6,7-dimethyl-8-ribityllumazine synthase, chloroplastic OS=Spinacia oleracea E-value=2e-14; 6,7-dimethyl-8-ribityllumazine synthase OS=Kosmotoga olearia (strain TBF 19.5.1) E-value=7e-06; |
Length | 483 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | TGGGGCTACTATATATAATCCTTTTCAGTTCAGTCGTTCTTCTTCATCTCAATCAATCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819010 |
Trichome-related Gene from Literature | N/A |