| Detail of EST/Unigene AL371191 |
| Acc. | AL371191 |
| Internal Acc. | MtBA42E02F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 6,7-dimethyl-8-ribityllumazine synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-19; 6,7-dimethyl-8-ribityllumazine synthase, chloroplastic OS=Spinacia oleracea E-value=2e-14; 6,7-dimethyl-8-ribityllumazine synthase OS=Kosmotoga olearia (strain TBF 19.5.1) E-value=7e-06; |
| Length | 483 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | TGGGGCTACTATATATAATCCTTTTCAGTTCAGTCGTTCTTCTTCATCTCAATCAATCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819010 |
| Trichome-related Gene from Literature | N/A |