Detail of EST/Unigene AL371192 |
Acc. | AL371192 |
Internal Acc. | MtBA42E03F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-80; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=6e-78; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=2e-75; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=4e-75; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=1e-74; |
Length | 468 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | AAAACACTCTCATCAACAACAACAACAATGGCTTCTTCATCCAAACCAACACCACTTGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |