Detail of EST/Unigene AL371412 |
Acc. | AL371412 |
Internal Acc. | MtBA44A09F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF3 OS=Nicotiana tabacum E-value=7e-42; Mitogen-activated protein kinase homolog 1 OS=Petunia hybrida E-value=6e-41; Mitogen-activated protein kinase 2 OS=Arabidopsis thaliana E-value=1e-40; Mitogen-activated protein kinase 1 OS=Arabidopsis thaliana E-value=9e-39; Mitogen-activated protein kinase 7 OS=Arabidopsis thaliana E-value=2e-38; |
Length | 407 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | CGAACATACTCAACTTCACTCATCCTTCTCTCAATTACTTTTCATTCTTCCACACCTTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase |
EC | 2.7.11.24 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842248 |
Trichome-related Gene from Literature | N/A |