| Detail of EST/Unigene AL371577 |
| Acc. | AL371577 |
| Internal Acc. | MtBA45B03R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | BTB/POZ and TAZ domain-containing protein 1 OS=Arabidopsis thaliana E-value=1e-44; BTB/POZ and TAZ domain-containing protein 2 OS=Arabidopsis thaliana E-value=2e-43; BTB/POZ and TAZ domain-containing protein 4 OS=Arabidopsis thaliana E-value=9e-33; BTB/POZ and TAZ domain-containing protein 5 OS=Arabidopsis thaliana E-value=1e-26; BTB/POZ and TAZ domain-containing protein 3 OS=Arabidopsis thaliana E-value=1e-23; |
| Length | 510 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | TTGTCCGAGACATTATTGTTACAATATTCATTGTAACCAAAACATCTGATCCCACGATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04498 E1A/CREB-binding protein |
| EC | 2.3.1.48 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836437 |
| Trichome-related Gene from Literature | N/A |