Detail of EST/Unigene AL371907 |
Acc. | AL371907 |
Internal Acc. | MtBA47C06R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cystathionine gamma-synthase, chloroplastic OS=Arabidopsis thaliana E-value=8e-31; Cystathionine gamma-lyase OS=Dictyostelium discoideum E-value=1e-11; Cystathionine gamma-synthase OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=1e-10; Putative cystathionine gamma-lyase 2 OS=Caenorhabditis elegans E-value=1e-09; Cystathionine gamma-lyase OS=Sus scrofa E-value=7e-09; |
Length | 453 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | TATAACAACCACAATTAAATTTATTGATTCACTAAAAATCCCATATATTGCTGCCTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01758 cystathionine gamma-lyase |
EC | 4.4.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821292 |
Trichome-related Gene from Literature | N/A |