| Detail of EST/Unigene AL372097 |
| Acc. | AL372097 |
| Internal Acc. | MtBA48F01F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=8e-64; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-46; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Daucus carota E-value=1e-40; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=1e-39; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=2e-39; |
| Length | 413 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | ACAATGGCTATCTCTCCAATTTTATTGATAGCTCTCTTCTCTCTTATTTATGGCAATTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820591 |
| Trichome-related Gene from Literature | N/A |