Detail of EST/Unigene AL372097 |
Acc. | AL372097 |
Internal Acc. | MtBA48F01F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=8e-64; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-46; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Daucus carota E-value=1e-40; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=1e-39; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=2e-39; |
Length | 413 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | ACAATGGCTATCTCTCCAATTTTATTGATAGCTCTCTTCTCTCTTATTTATGGCAATTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |