Detail of EST/Unigene AL372981 |
Acc. | AL372981 |
Internal Acc. | MtBA54H09R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=1e-23; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=2e-23; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=5e-23; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=2e-22; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=1e-21; |
Length | 492 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | AAAGGTTTCTTAATTCGAATGTAGATTTTAAAGGGAGAGATTTTGAGTATTTACCTTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819164 |
Trichome-related Gene from Literature | N/A |