Detail of EST/Unigene AL373090 |
Acc. | AL373090 |
Internal Acc. | MtBA55E12R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=6e-11; Transketolase, chloroplastic OS=Spinacia oleracea E-value=1e-10; Transketolase, chloroplastic OS=Solanum tuberosum E-value=7e-10; Transketolase 7 OS=Craterostigma plantagineum E-value=4e-09; Transketolase, chloroplastic OS=Zea mays E-value=6e-09; |
Length | 366 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | AAGCAAGGGAAAAACCATTGGCATTGATCGATTTGGAGCTAGTGCTCCAGCAGGGAAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |