Detail of EST/Unigene AL373460 |
Acc. | AL373460 |
Internal Acc. | MtBA57H12F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Secologanin synthase OS=Catharanthus roseus E-value=8e-39; Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=3e-36; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=6e-31; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=1e-30; Cytokinin hydroxylase OS=Arabidopsis thaliana E-value=5e-29; |
Length | 536 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | TGTCATGCACTTCGTGACAGATGGTGACATCTCTAACTATCAAATCCATGATGGGCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K01832 cytochrome P450, family 5, subfamily A (thromboxane-A synthase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
EC | 1.14.15.3 5.3.99.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820689 |
Trichome-related Gene from Literature | N/A |