| Detail of EST/Unigene AL375404 |
| Acc. | AL375404 |
| Internal Acc. | MtBB14D08F1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-17; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=8e-17; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-15; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-14; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-12; |
| Length | 425 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (1 ESTs); |
| Sequence | ATCAAAATGAAGTTGGAGCAAATGTAACTAATGCAAGGACGTATAATTATAACTTGCGTA |
| EST members of Unigene | AL375404 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.31686.1.S1_at
|
| Corresponding NCBI Gene | 820823 |
| Trichome-related Gene from Literature | N/A |