Detail of EST/Unigene AL375404 |
Acc. | AL375404 |
Internal Acc. | MtBB14D08F1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-17; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=8e-17; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-15; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-14; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-12; |
Length | 425 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (1 ESTs); |
Sequence | ATCAAAATGAAGTTGGAGCAAATGTAACTAATGCAAGGACGTATAATTATAACTTGCGTA |
EST members of Unigene | AL375404 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31686.1.S1_at
|
Corresponding NCBI Gene | 820823 |
Trichome-related Gene from Literature | N/A |