Detail of EST/Unigene AL381322 |
Acc. | AL381322 |
Internal Acc. | MtBC019C09F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 3, mitochondrial OS=Glycine max E-value=5e-84; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=1e-73; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=9e-70; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=9e-70; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=6e-68; |
Length | 489 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TCTAAGAAAATTTCAACACACTGGTGGTTGGATCAAAGCATTACTTGAAGAAGCAGAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |