Detail of EST/Unigene AL381390 |
Acc. | AL381390 |
Internal Acc. | MtBC019G04R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=1e-42; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=7e-39; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=1e-38; Ferredoxin-6, chloroplastic OS=Zea mays E-value=8e-38; Ferredoxin, root R-B2 OS=Raphanus sativus E-value=1e-37; |
Length | 528 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TTACAAGGTTAAGCTAATTGGACCAGATGGAAAAGAGAATGAGTTTGACGCCCCCGATGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817297 |
Trichome-related Gene from Literature | N/A |