| Detail of EST/Unigene AL381596 |
| Acc. | AL381596 |
| Internal Acc. | MtBC01H05R2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Tagetes erecta E-value=1e-51; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-51; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=2e-49; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=2e-49; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Zea mays E-value=2e-48; |
| Length | 520 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | GCCCTTGCCAAATGAAGAAATTATTTCGAGAGTAGCAAAACAGGTTATATCATTGTTCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819647 |
| Trichome-related Gene from Literature | N/A |