| Detail of EST/Unigene AL381799 |
| Acc. | AL381799 |
| Internal Acc. | MtBC03A08F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=2e-16; Probable NAD(P)H-dependent oxidoreductase 1 OS=Oryza sativa subsp. japonica E-value=4e-16; Probable NAD(P)H-dependent oxidoreductase 2 OS=Oryza sativa subsp. japonica E-value=3e-15; Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=7e-15; Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=1e-14; |
| Length | 291 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | ATGGAACACTGATGCAGATTATGATCTTATTGTTCCAGCTCTCAAAACCACATTAAAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00212 trans-1,2-dihydrobenzene-1,2-diol dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K05295 20alpha-hydroxysteroid dehydrogenase |
| EC | 1.1.1.149 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818354 |
| Trichome-related Gene from Literature | N/A |