Detail of EST/Unigene AL382025 |
Acc. | AL382025 |
Internal Acc. | MtBC04D07F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=2e-50; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=1e-29; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-29; Fructan 6-exohydrolase OS=Beta vulgaris E-value=4e-28; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=1e-27; |
Length | 330 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | GAAAGGATGGTCTGGAATCCATACTATTCCAAGGGTTATCTGGCTTCATAAATCAGGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841955 |
Trichome-related Gene from Literature | N/A |