Detail of EST/Unigene AL382114 |
Acc. | AL382114 |
Internal Acc. | MtBC04H05F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=6e-70; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=9e-47; 50S ribosomal protein L22, chloroplastic OS=Ranunculus macranthus E-value=2e-23; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=2e-22; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=2e-22; |
Length | 461 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | CCAATGGCTCTTTCTTTAACCGCCATTAACCTTCCTCCTCCTCCTGTTCGCGATAACGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |