| Detail of EST/Unigene AL382301 |
| Acc. | AL382301 |
| Internal Acc. | MtBC06A04F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L51, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-10; 54S ribosomal protein L51, mitochondrial OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=1e-08; 54S ribosomal protein L51, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-08; 39S ribosomal protein L43, mitochondrial OS=Mus musculus E-value=3e-07; |
| Length | 448 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | CTAACGCCGCACAGCTCACAGAGTCTCCGTCTCCGATCACCGTCAGCCGTCCAACAACCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825134 |
| Trichome-related Gene from Literature | N/A |