Detail of EST/Unigene AL382301 |
Acc. | AL382301 |
Internal Acc. | MtBC06A04F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L51, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-10; 54S ribosomal protein L51, mitochondrial OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=1e-08; 54S ribosomal protein L51, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-08; 39S ribosomal protein L43, mitochondrial OS=Mus musculus E-value=3e-07; |
Length | 448 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | CTAACGCCGCACAGCTCACAGAGTCTCCGTCTCCGATCACCGTCAGCCGTCCAACAACCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825134 |
Trichome-related Gene from Literature | N/A |