| Detail of EST/Unigene AL382941 |
| Acc. | AL382941 |
| Internal Acc. | MtBC10H04F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglucomutase, cytoplasmic OS=Pisum sativum E-value=8e-48; Phosphoglucomutase, cytoplasmic OS=Solanum tuberosum E-value=4e-40; Probable phosphoglucomutase, cytoplasmic 1 OS=Arabidopsis thaliana E-value=1e-39; Phosphoglucomutase, cytoplasmic OS=Populus tremula E-value=2e-39; Probable phosphoglucomutase, cytoplasmic 2 OS=Arabidopsis thaliana E-value=5e-39; |
| Length | 466 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | TCAAACTGCAGTCCTCACTTTCAGAAGCCAATGGGATTGTTAAGGGGGCAAGTTCAGATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01835 phosphoglucomutase |
| EC | 5.4.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838927 |
| Trichome-related Gene from Literature | N/A |