| Detail of EST/Unigene AL383156 |
| Acc. | AL383156 |
| Internal Acc. | MtBC12B11R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=2e-20; Ferritin-3, chloroplastic OS=Glycine max E-value=2e-20; Ferritin-4, chloroplastic OS=Glycine max E-value=4e-20; Ferritin-2, chloroplastic OS=Arabidopsis thaliana E-value=4e-20; Ferritin-1, chloroplastic OS=Nicotiana tabacum E-value=4e-18; |
| Length | 295 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | ACTGGTGATGTGAATTTGGCAGACTTTGTGGAAAGTGAGTTTTTGGGTGAACAGGTGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.16.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820276 |
| Trichome-related Gene from Literature | N/A |