Detail of EST/Unigene AL383197 |
Acc. | AL383197 |
Internal Acc. | MtBC12E07F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-61; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-60; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-56; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=8e-51; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-45; |
Length | 372 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | AAAAGGGTCATCAACCTAACATGAGAGAGGTGACTTCAGCACAAGATCTTGTAGATTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837379 |
Trichome-related Gene from Literature | N/A |