Detail of EST/Unigene AL383238 |
Acc. | AL383238 |
Internal Acc. | MtBC12H05F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dynein light chain 2, cytoplasmic OS=Rattus norvegicus E-value=2e-30; Dynein light chain 2, cytoplasmic OS=Mus musculus E-value=2e-30; Dynein light chain 2, cytoplasmic OS=Homo sapiens E-value=2e-30; Dynein light chain 2, cytoplasmic OS=Bos taurus E-value=2e-30; Dynein light chain 1, cytoplasmic OS=Caenorhabditis elegans E-value=3e-30; |
Length | 473 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TGCAAGAGAGAGAATTAGGTAAAGAAAGATGAGCGAGGAGGCGAAGAAGCACAGCGCANG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827275 |
Trichome-related Gene from Literature | N/A |