| Detail of EST/Unigene AL383547 |
| Acc. | AL383547 |
| Internal Acc. | MtBC15A06F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--nitrite reductase, chloroplastic OS=Betula pendula E-value=2e-74; Ferredoxin--nitrite reductase, chloroplastic OS=Spinacia oleracea E-value=4e-72; Ferredoxin--nitrite reductase, chloroplastic OS=Arabidopsis thaliana E-value=1e-71; Ferredoxin--nitrite reductase, chloroplastic (Fragment) OS=Zea mays E-value=3e-69; Ferredoxin--nitrite reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-68; |
| Length | 476 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | GCGATGTGCTGAAGCAGTTCCACTTGATGCTTGGGTCTCTGCAGATGATGTTATCCCACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816055 |
| Trichome-related Gene from Literature | N/A |