Detail of EST/Unigene AL383747 |
Acc. | AL383747 |
Internal Acc. | MtBC16E03F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=5e-12; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; Ferredoxin-1, chloroplastic OS=Solanum lycopersicum E-value=2e-08; Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=2e-08; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-08; |
Length | 315 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TTTTCAGTTCTTTCTCATTCATTCACTTCATTCTTGTTCAACTAATAAAAATGTCAGCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817297 |
Trichome-related Gene from Literature | N/A |