| Detail of EST/Unigene AL383747 |
| Acc. | AL383747 |
| Internal Acc. | MtBC16E03F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=5e-12; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; Ferredoxin-1, chloroplastic OS=Solanum lycopersicum E-value=2e-08; Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=2e-08; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-08; |
| Length | 315 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | TTTTCAGTTCTTTCTCATTCATTCACTTCATTCTTGTTCAACTAATAAAAATGTCAGCGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817297 |
| Trichome-related Gene from Literature | N/A |