Detail of EST/Unigene AL383984 |
Acc. | AL383984 |
Internal Acc. | MtBC18B11F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=3e-42; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=1e-24; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=2e-23; Probable beta-1,3-galactosyltransferase 5 OS=Arabidopsis thaliana E-value=2e-23; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=3e-23; |
Length | 441 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | ACAAGAGGGTTTTGTTTCAAAGGGATTGATTGAGACCAATGGGACTTACTCTAAGAGACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835415 |
Trichome-related Gene from Literature | N/A |