Detail of EST/Unigene AL384661 |
Acc. | AL384661 |
Internal Acc. | MtBC23F05F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=3e-22; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=4e-21; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=2e-20; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=2e-20; Peroxiredoxin Q, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-20; |
Length | 343 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | CGGGACAATTGAAGGTAATATTTCCATCGCGGGACATTATAACTGTTTGATCTCTATATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |