| Detail of EST/Unigene AL384661 |
| Acc. | AL384661 |
| Internal Acc. | MtBC23F05F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=3e-22; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=4e-21; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=2e-20; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=2e-20; Peroxiredoxin Q, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-20; |
| Length | 343 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | CGGGACAATTGAAGGTAATATTTCCATCGCGGGACATTATAACTGTTTGATCTCTATATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |