| Detail of EST/Unigene AL384756 |
| Acc. | AL384756 |
| Internal Acc. | MtBC24C06R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin HYR1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=4e-41; Glutathione peroxidase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-40; Glutathione peroxidase 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=5e-39; Putative glutathione peroxidase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=1e-38; Glutathione peroxidase homolog BsaA OS=Staphylococcus aureus (strain MW2) E-value=3e-35; |
| Length | 510 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | AGCATCAAAATGTGGTTATACTCCACAATATACTGGTCTTGAAAGTCTTCATAATAAATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
| EC | 1.11.1.12 1.11.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842652 |
| Trichome-related Gene from Literature | N/A |