Detail of EST/Unigene AL384831 |
Acc. | AL384831 |
Internal Acc. | MtBC24G05F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1B OS=Arabidopsis thaliana E-value=7e-53; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=2e-52; SKP1-like protein 4 OS=Arabidopsis thaliana E-value=9e-47; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=8e-46; SKP1-like protein 12 OS=Arabidopsis thaliana E-value=1e-44; |
Length | 432 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TCGATGAAGCTGTTGCTTTGGAATCTCAGACGATCAAGCATATGATCGAAGATGATTGCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834224 |
Trichome-related Gene from Literature | N/A |