| Detail of EST/Unigene AL385060 |
| Acc. | AL385060 |
| Internal Acc. | MtBC26B03R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acylpyruvase FAHD1, mitochondrial OS=Pongo abelii E-value=4e-22; Acylpyruvase FAHD1, mitochondrial OS=Homo sapiens E-value=5e-22; Acylpyruvase FAHD1, mitochondrial OS=Bos taurus E-value=7e-22; Acylpyruvase FAHD1, mitochondrial OS=Mus musculus E-value=5e-21; Acylpyruvase FAHD1, mitochondrial OS=Rattus norvegicus E-value=1e-20; |
| Length | 495 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | CTGCAGTACCAAACCCTGATGATCTAGAGTTATGGCTAAAGGTAGATGAGGAAATTCGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820922 |
| Trichome-related Gene from Literature | N/A |