Detail of EST/Unigene AL385182
Acc. AL385182
Internal Acc. MtBC26H03F1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) UDP-glucose flavonoid 3-O-glucosyltransferase 7 OS=Fragaria ananassa E-value=1e-23; UDP-glycosyltransferase 73B4 OS=Arabidopsis thaliana E-value=1e-22; UDP-glycosyltransferase 73B1 OS=Arabidopsis thaliana E-value=1e-22; Anthocyanidin 3-O-glucosyltransferase 4 (Fragment) OS=Manihot esculenta E-value=2e-22; UDP-glucosyl transferase 73B2 OS=Arabidopsis thaliana E-value=8e-22;
Length 194 nt
Species Medicago truncatula
Belonged EST Libraries MtBC_GLOMUS;
Sequence TCATAAGGGGGTGGGCCCCACAAGTGGTGATTTTAGGCCACCCTGCTATCGGTGCATTCT
TGACACATTGCGGGTGGAACTCCACCGTGGAAGCCGTTAGTGCAGGGGTTCCAATGATCA
CGTGGCCAGTGCATGACGAACAATTCTACAACGAGAAGTTGATAACTCAGGTGCGGGGTA
TTGGTGTGGAGGTT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase;
Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase;
Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase;
Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase;
EC 2.4.1.17  2.4.1.47 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 829561 
Trichome-related Gene from Literature N/A