Detail of EST/Unigene AL385249 |
Acc. | AL385249 |
Internal Acc. | MtBC27D02R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=6e-41; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=1e-40; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-40; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=9e-39; |
Length | 473 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | GTGTTTCTTTCATGGTTGACAACTGCTCAACCACAGCAAGGTTAGGTTCAAGGAAATGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |