| Detail of EST/Unigene AL385320 |
| Acc. | AL385320 |
| Internal Acc. | MtBC27G08R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Citrullus lanatus E-value=2e-26; Cysteine synthase OS=Solanum tuberosum E-value=3e-26; Cysteine synthase OS=Spinacia oleracea E-value=1e-25; Cysteine synthase OS=Zea mays E-value=5e-25; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=9e-25; |
| Length | 459 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | CCTAGATGAAGTTATTCAGGTTTCAAGTGAAGAAGCTATAGAAACTGCTAAGCTGCTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819654 |
| Trichome-related Gene from Literature | N/A |