| Detail of EST/Unigene AL385506 |
| Acc. | AL385506 |
| Internal Acc. | MtBC29A01F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=7e-60; Argininosuccinate synthase OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=3e-45; Argininosuccinate synthase OS=Roseiflexus sp. (strain RS-1) E-value=1e-44; Argininosuccinate synthase OS=Roseiflexus castenholzii (strain DSM 13941 / HLO8) E-value=7e-44; Argininosuccinate synthase OS=Desulfotomaculum reducens (strain MI-1) E-value=2e-43; |
| Length | 361 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | AATTTATGAGAGGAAGTATTTGCTTGGAACTGCAATAGCTCGCCCTGTAATTGCAAAGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
| EC | 6.3.4.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828586 |
| Trichome-related Gene from Literature | N/A |