Detail of EST/Unigene AL385507 |
Acc. | AL385507 |
Internal Acc. | MtBC29A01R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; Argininosuccinate synthase OS=Moorella thermoacetica (strain ATCC 39073) E-value=3e-23; Argininosuccinate synthase OS=Desulfotomaculum reducens (strain MI-1) E-value=7e-23; Argininosuccinate synthase OS=Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680) E-value=3e-22; Argininosuccinate synthase OS=Clostridium kluyveri (strain NBRC 12016) E-value=3e-22; |
Length | 420 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | ATGCTGGAAGATGGTTTGATCCACTTCGCGAATCGATGGATTCATTCATGGAGAAGATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |