Detail of EST/Unigene AL385532 |
Acc. | AL385532 |
Internal Acc. | MtBC29B03R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=6e-42; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=1e-38; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=1e-38; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=1e-31; Aldose reductase OS=Hordeum vulgare E-value=1e-17; |
Length | 448 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TGGAACAACCTGGCTTCAAAGTGATGTCATTAAGCATCCAGTTCTTAACATGATTGCTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00251 3-oxo-5beta-steroid 4-dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00251 3-oxo-5beta-steroid 4-dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00251 3-oxo-5beta-steroid 4-dehydrogenase |
EC | 1.1.1.2 1.3.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818354 |
Trichome-related Gene from Literature | N/A |